Select: All | None

Select: All | None

Select: All | None

BIOMARKERS FOR DENGUE

Mahidol University, McGill University

The present invention provides protein-based biomarkers and biomarker combinations that are useful in qualifying dengue status in a patient. In particular, the biomarkers of this invention are useful to classify a subject sample as infected with dengue or not infected with dengue. The biomarkers can be detected by SELDI mass spectrometry.

WEARABLE RESPIRATION SENSOR AND RESPIRATION MONITORING SYSTEM

Laval University

There is described a wearable respiration sensor generally having a stretchable textile substrate to be worn around a user's torso; and a dipole antenna having two flexible conductive elements extending in opposite directions from a center, relative to a dipole axis, and being secured to the stretchable textile substrate, each of the two flexible conductive elements having a proximate end near the center, a distal end away from the center, and a curved portion curving away from and back...

Polymorphisms predictive of anthracycline-induced cardiotoxicity

University of British Columbia

Provided are methods, nucleic acids, and arrays for assessing the susceptibility of a subject to the development of cardiotoxicity in response to receiving one or more anthracycline compounds, the method including determining the presence or absence of one or more polymorphisms, wherein the presence or absence of one or more such polymorphisms is indicative of susceptibility to the development of cardiotoxicity.

PORPHYRIN COMPOUNDS AND THEIR USE AS MRI CONTRAST AGENTS

Hospital for Sick Children, University of Toronto

Water soluble porphyrin compounds useful in the field of magnetic resonance imaging (MRl) as contrast agents. Particular compounds include manganese.

STRUCTURE DEFECT DETECTION USING MACHINE LEARNING ALGORITHMS

University of Manitoba

Structure defect detection is performed using computer-implemented arrangements employing machine learning algorithms in the form of neural networks. In one arrangement, a convolutional neural network is trained using a database of images formed to optimize accuracy of the convolutional neural network to detect, for example, a crack in a concrete surface. A two-stage scanning process each performing a plurality of scans of a test image is incorporated in the foregoing arrangement of...

CHANNELRHODOPSINS FOR OPTICAL CONTROL OF CELLS

Massachusetts Institute of Technology, University of Alberta

The invention, in some aspects relates to compositions and methods for altering cell activity and function and the introduction and use of light-activated ion channels.

HEPATITIS C VIRUS E1/E2 HETERODIMERS AND METHODS OF PRODUCING SAME

University of Alberta

The present disclosure provides affinity tagged heterodimeric polypeptides comprising a hepatitis C virus (HCV) El polypeptide and an HCV E2 polypeptide, where one or both of the El and E2 polypeptides comprises an affinity tag. The present disclosure provides a method of producing an affinity tagged E1/E2 heterodimer of the present disclosure. The present disclosure provides methods of producing untagged HCV E1/E2 heterodimers. The present disclosure provides HCV E1/E2 heterodimers,...

POLYMORPHISMS PREDICTIVE OF PLATINUM-COORDINATING COMPLEX-INDUCED OTOTOXICITY

University of British Columbia

Provided are methods, nucleic acids, and arrays for assessing the suscept ibility of a subject to the development of ototoxicity in response to receiv ing one or more platinum-coordinating compounds, the method including determ ining the presence or absence of one or more polymorphisms, wherein the pres ence or absence of one or more such polymorphisms is indicative of susceptib ility to the development of ototoxicity.

CARDIOVASCULAR PULSE WAVE ANALYSIS METHOD AND SYSTEM

University of Winnipeg

Factor retrieving is a major approach for pulse wave analysis. Stiffness index and cardiac output are widely used factors for cardiac risk detection. Research has been done on clinical pulse wave data which are collected by pulse oximeter. The result shows that collected factors have a positive correlation with certain cardiac risks. Some adjustments have been applied on the algorithms that increase the significance. In addition to the factor based analysis, other signal processing...

METHOD FOR TREATING NON-SMALL CELL LUNG CANCER

TEVA PHARMACEUTICAL INDUSTRIES, University of British Columbia

A method of treating a human patient afflicted with lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of a taxane and 640mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti- clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2 ' -O-methoxyethyl modifications, has nucleotides 5-17 which are 2 '...